Sequence ID | >WENV170683927 |
Genome ID | LFRM01010453 |
Search identical group | |
Phylum/Class | [LFRM] anaerobic digester metagenome; pool of bioreactors CSTR01a, CSTR02a, and CSTR03a; thermophilic anaerobic digestion of cattle |
Species | |
Start position on genome | 459 |
End posion on genome | 546 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tacatcataT |
tRNA gene sequence |
GCCGGGATAGCCTAGCCAGGTAAGGCGCAAGACTGGAAATCTTGTGGAGCTCTGCTCCTC |
Downstream region at tRNA end position |
gttgaagcaa |
Secondary structure (Cloverleaf model) | >WENV170683927 Ser GGA T GTCg gttgaagcaa G - C C - G C - G G - C G - C G - C A - T T A T G A C C C A C G A A | | | | | A C T C C G C T G G G C A | | | | T T G A G G C G T A G TGGAGCTCTGCTCCTC C - G A - T A - T G - C A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |