Sequence ID | >WENV170684015 |
Genome ID | LFRM01014924 |
Search identical group | |
Phylum/Class | [LFRM] anaerobic digester metagenome; pool of bioreactors CSTR01a, CSTR02a, and CSTR03a; thermophilic anaerobic digestion of cattle |
Species | |
Start position on genome | 184 |
End posion on genome | 108 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
acaaccagat |
tRNA gene sequence |
TGCGGGGTGGAGCAGCCTGGTAGCTCGTCAGGCTCATAACCTGAAGGTCGTTGGTTCAAA |
Downstream region at tRNA end position |
atttcagcct |
Secondary structure (Cloverleaf model) | >WENV170684015 Met CAT t ACCA atttcagcct T T G - C C - G G - C G - C G - C G - C T A T C A A C C A C G A G | | | | | A C C G A G G T T G G C T | | | | T T G G C T C G T A G AGGTC T - A C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |