Sequence ID | >WENV170688789 |
Genome ID | LFRM01261633 |
Search identical group | |
Phylum/Class | [LFRM] anaerobic digester metagenome; pool of bioreactors CSTR01a, CSTR02a, and CSTR03a; thermophilic anaerobic digestion of cattle |
Species | |
Start position on genome | 29882 |
End posion on genome | 29968 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tgtggcccaa |
tRNA gene sequence |
GCGGAGGTGGCCCAGCCTGGCAAGGCGCAGGATTGCTAATCCTGTGTCCGCAAGGACTCG |
Downstream region at tRNA end position |
ctttccaatc |
Secondary structure (Cloverleaf model) | >WENV170688789 Ser GCT a GCCA ctttccaatc G - C C - G G - C G - C A - T G - C G - C T A T C C C C C A C G A G | | | | | A C C C C G G G G G G C T | | | T T G A G G C G C A G TGTCCGCAAGGACTC C - G A - T G - C G - C A - T T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |