Sequence ID | >WENV170689575 |
Genome ID | LFRM01301097 |
Search identical group | |
Phylum/Class | [LFRM] anaerobic digester metagenome; pool of bioreactors CSTR01a, CSTR02a, and CSTR03a; thermophilic anaerobic digestion of cattle |
Species | |
Start position on genome | 5408 |
End posion on genome | 5322 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gctggtcgaa |
tRNA gene sequence |
GCAGGGGTAGCCAAGCTTGGCCAACGGCGCAAGGTTGAGGGCCTTGTCCTTAGTGGTCCG |
Downstream region at tRNA end position |
ccatcccctt |
Secondary structure (Cloverleaf model) | >WENV170689575 Leu GAG a ACCA ccatcccctt G - C C - G A - T G - C G - C G - C G - C T A T T T C C C A T C G A A + | | | | A T A C C G G A G G G C G | | | T T G C G G C C C A A G TCCTTAGTGGTCC C - G A - T A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |