Sequence ID | >WENV170691468 |
Genome ID | LFRM01398565 |
Search identical group | |
Phylum/Class | [LFRM] anaerobic digester metagenome; pool of bioreactors CSTR01a, CSTR02a, and CSTR03a; thermophilic anaerobic digestion of cattle |
Species | |
Start position on genome | 872 |
End posion on genome | 797 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tctttcggtt |
tRNA gene sequence |
GGGTCGTTAGCTCAGTCGGTAGAGCAGCGGACTTTTAATCCGTTGGTCGCGCGTTCGAGT |
Downstream region at tRNA end position |
acccgaattc |
Secondary structure (Cloverleaf model) | >WENV170691468 Lys TTT t ACCA acccgaattc G - C G - C G - C T - A C - G G - C T - A T G T C G C G C A T G A A | | | | | G C C T C G G C G C G C G | | | | T T G G A G C T A A TGGTC G + T C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |