Sequence ID | >WENV170692280 |
Genome ID | LGOV01001916 |
Search identical group | |
Phylum/Class | [LGOV] marine sediment metagenome; sample #5579, elevator 3A push core 41 containing 12 cm of sediment, collected at Hydrate Ridge |
Species | |
Start position on genome | 3497 |
End posion on genome | 3423 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gtagttttat |
tRNA gene sequence |
TGGGGCGTCGCCAAGCGGTAAGGCACCGGATTTTGATTCCGGCATTCACAGGTTCGATCC |
Downstream region at tRNA end position |
tttaaaaact |
Secondary structure (Cloverleaf model) | >WENV170692280 Gln TTG t GCCA tttaaaaact T - A G - C G - C G - C G - C C - G G - C C T T T G T C C A G A C | | | | | G C A C C G A C A G G C G | | | T T G A G G C T A A CATTC C - G C - G G - C G - C A - T T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |