Sequence ID | >WENV170693248 |
Genome ID | LGVC01000060 |
Search identical group | |
Phylum/Class | [LGVC] marine sediment metagenome; sample #5133, Elevator 3A push core 47, collected at Hydrate Ridge North during Jason II dive |
Species | |
Start position on genome | 2492 |
End posion on genome | 2585 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gaagaacccc |
tRNA gene sequence |
GGAGAGATGTCCGAGCTGGTTGAAGGAGCACGACTGGAAATCGTGTGTACTGTCAAAAGC |
Downstream region at tRNA end position |
ggaatttttt |
Secondary structure (Cloverleaf model) | >WENV170693248 Ser GGA c GCCA ggaatttttt G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T C G A G | | | | | G G G C C T G A G G G C G | | | T T T A G G A T G A G TGTACTGTCAAAAGCGGTACC C - G A - T C - G G - C A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |