Sequence ID | >WENV170693375 |
Genome ID | LGVC01005348 |
Search identical group | |
Phylum/Class | [LGVC] marine sediment metagenome; sample #5133, Elevator 3A push core 47, collected at Hydrate Ridge North during Jason II dive |
Species | |
Start position on genome | 78 |
End posion on genome | 153 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tatttttttt |
tRNA gene sequence |
GCGGGCATAGCTCAGCTGGTAGAGTACAAGCTTCCCAAGCTTGGTGTCGCGGGTTCGAAC |
Downstream region at tRNA end position |
gcgtgtccct |
Secondary structure (Cloverleaf model) | >WENV170693375 Gly CCC t TCCA gcgtgtccct G - C C - G G - C G - C G - C C - G A - T C A T T G C C C A C G A A + | | | | G T C T C G G C G G G C G | | | + T T G G A G T T A A GTGTC C - G A - T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |