Sequence ID | >WENV170694081 |
Genome ID | LGVD01009912 |
Search identical group | |
Phylum/Class | [LGVD] marine sediment metagenome; sample #3730, Push core (PC) 16 from cruise R/V Atlantis leg AT-15-68, Alvin dive 4635 at |
Species | |
Start position on genome | 316 |
End posion on genome | 219 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
tcttcataat |
tRNA gene sequence |
GGAAGTGGATAGCTCACTGGTGGAGCTCCCGGACTTCAAATCCGGTGTGGGGCGTTAACA |
Downstream region at tRNA end position |
atggtttgca |
Secondary structure (Cloverleaf model) | >WENV170694081 SeC(p) TCA t GCCA atggtttgca G - C G - C A - T A - T G - C T - A G - C G G T T A T A C C C A C A C T + | | | | G T T C G A G T G G G C G | | | | T T G A G C T T G G C TGTGGGGCGTTAACACCGTCTCGG C - G C - G G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |