Sequence ID | >WENV170695037 |
Genome ID | LGVE01036524 |
Search identical group | |
Phylum/Class | [LGVE] marine sediment metagenome; combined push core samples #3730, #5133, and #5579 collected at Hydrate Ridge |
Species | |
Start position on genome | 4550 |
End posion on genome | 4475 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
attcctaccT |
tRNA gene sequence |
GCCCAGGTAGCTCAGTCTGGGAGAGCGCTGCCCTGAAGAGGCAGTTGTCCCCGGTTCAAA |
Downstream region at tRNA end position |
attttttgta |
Secondary structure (Cloverleaf model) | >WENV170695037 Phe GAA T ATtt attttttgta G - C C - G C - G C - G A - T G - C G + T T A T G G G C C A T G A A | | | | | A C C T C G C C C G G C T | | | | T T G G A G C G G A G TTGTC C - G T - A G - C C - G C - G C A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |