Sequence ID | >WENV170695050 |
Genome ID | LGVE01038701 |
Search identical group | |
Phylum/Class | [LGVE] marine sediment metagenome; combined push core samples #3730, #5133, and #5579 collected at Hydrate Ridge |
Species | |
Start position on genome | 688 |
End posion on genome | 613 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
aatttgggat |
tRNA gene sequence |
GCGGGCATAGCTCAGCCGGTAGAGTACAAGCTTCCCAAGCTTGGTGTCGCGAGTTCGAAT |
Downstream region at tRNA end position |
tgaacgtccg |
Secondary structure (Cloverleaf model) | >WENV170695050 Gly CCC t TCCA tgaacgtccg G - C C - G G - C G - C G - C C - G A - T T A T C G C T C A C G A A | | | | | G C C T C G G C G A G C G | | | + T T G G A G T T A A GTGTC C - G A - T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |