Sequence ID | >WENV170695644 |
Genome ID | LGVE01141412 |
Search identical group | |
Phylum/Class | [LGVE] marine sediment metagenome; combined push core samples #3730, #5133, and #5579 collected at Hydrate Ridge |
Species | |
Start position on genome | 2031 |
End posion on genome | 2107 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
tttttaatat |
tRNA gene sequence |
GGCCGCGTAGTTCAACTGGATAGAATATCAGATTTCGGCTCTGAGGGTTGGGGGTTCGAA |
Downstream region at tRNA end position |
atgaattaaa |
Secondary structure (Cloverleaf model) | >WENV170695644 Arg TCG t ACAA atgaattaaa G - C G + T C - G C - G G - C C - G G - C T A T T C T C C A C A A A + | + | | G T C T T G G G G G G C G | | | + T T G G A A T A T A A GGGTT T - A C - G A - T G - C A - T T C T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |