Sequence ID | >WENV170696009 |
Genome ID | LGVE01196319 |
Search identical group | |
Phylum/Class | [LGVE] marine sediment metagenome; combined push core samples #3730, #5133, and #5579 collected at Hydrate Ridge |
Species | |
Start position on genome | 228 |
End posion on genome | 142 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
atcacttcaa |
tRNA gene sequence |
GCCGGAGTGGTGGAATTGGTAGACACGCATGATTCAGGTTCATGTGCTCGAAAGGGCGTG |
Downstream region at tRNA end position |
aaaaaattaa |
Secondary structure (Cloverleaf model) | >WENV170696009 Leu CAG a ACCA aaaaaattaa G - C C - G C - G G - C G + T A - T G - C T C T C C C T C A T A A G | | | | | G T G G T G G G G A G C G | | | T T G A C A C T A G G TGCTCGAAAGGGCGT C - G A - T T - A G - C A - T T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |