Sequence ID | >WENV170696271 |
Genome ID | LGVF01008868 |
Search identical group | |
Phylum/Class | [LGVF] marine sediment metagenome; combined push core samples #3730, #5133, and #5579 collected at Hydrate Ridge |
Species | |
Start position on genome | 29153 |
End posion on genome | 29078 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
atcactttgg |
tRNA gene sequence |
GGGTCGTTAACTCAGCTGGTAGAGTATCTGACTTTTAATCAGAGAGTCGCGCGTTCGAGC |
Downstream region at tRNA end position |
tcgacctgtc |
Secondary structure (Cloverleaf model) | >WENV170696271 Lys TTT g ACCA tcgacctgtc G - C G - C G - C T - A C - G G - C T - A C G T C G C G C A C G A A | | | | | G T C T C A G C G C G C G | | | | T T G G A G T T A A GAGTC T - A C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |