| Sequence ID | >WENV170697042 |
| Genome ID | LGVF01076043 |
| Phylum/Class | [LGVF] marine sediment metagenome; combined push core samples #3730, #5133, and #5579 collected at Hydrate Ridge |
| Species | |
|
Start position on genome
|
255
|
|
End posion on genome
|
326
|
|
Amino Acid
|
Cys
|
|
Anticodon
|
GCA
|
|
Upstream region at tRNA start position
|
aaaccctggc
|
|
tRNA gene sequence
|
GCCAAGGTGGCGGAGCGGCTACGCAATCGCCTGCAGAGCGATACCATTCCGGTTCGAATC CGGACCTTGGCTtct
|
|
Downstream region at tRNA end position
|
ttcaaaaatg
|
| Secondary structure (Cloverleaf model) | >WENV170697042 Cys GCA
c Ttct ttcaaaaatg
G - C
C - G
C - G
A - T
A - T
G - C
G - C T A
T A G G C C A
G A G | | | | | G
C G G C G T C C G G C
G | | | T T
G A C G C
C T A ACCAT
A - T
T - A
C - G
G - C
C - G
C A
T G
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |