Sequence ID | >WENV170697311 |
Genome ID | LGVF01110543 |
Search identical group | |
Phylum/Class | [LGVF] marine sediment metagenome; combined push core samples #3730, #5133, and #5579 collected at Hydrate Ridge |
Species | |
Start position on genome | 469 |
End posion on genome | 395 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
agcattaaat |
tRNA gene sequence |
GGTCCCATCGTCTAGCGGTTAGGACGCCGGCCTCTCACGCCGGAAACCGGGGTTCAATTC |
Downstream region at tRNA end position |
gtaaattaaa |
Secondary structure (Cloverleaf model) | >WENV170697311 Glu CTC t ACCA gtaaattaaa G - C G + T T - A C - G C - G C - G A - T T T T G C C C C A C G A C | | | | | A G T C T G C G G G G C G + | | | T T T G G A C T A G AAAC C - G C - G G - C G - C C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |