Sequence ID | >WENV170700223 |
Genome ID | LIDZ01008572 |
Search identical group | |
Phylum/Class | [LIDZ] food metagenome; wine grapes on drying loft during traditional withering process |
Species | |
Start position on genome | 6554 |
End posion on genome | 6628 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gtgtcaggtt |
tRNA gene sequence |
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC |
Downstream region at tRNA end position |
ttctatagtt |
Secondary structure (Cloverleaf model) | >WENV170700223 Arg CCT t ACCA ttctatagtt G - C T - A C - G T + G C - G C - G T - A T T T C G T C C A T A A A | | | | | G G A T T G G C A G G C G | | | | T T A T A A C T A G AGTT A - T G - C C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |