Sequence ID | >WENV170701536 |
Genome ID | LKGT01010468 |
Search identical group | |
Phylum/Class | [LKGT] marine sediment metagenome; sediment sample collected at the water-sediment interface from the South Pacific gyre, IODP |
Species | |
Start position on genome | 3414 |
End posion on genome | 3500 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aaatttcrtT |
tRNA gene sequence |
GCGGGCGTCGCCCAGCCTGGCCAAAGGCGCTAGCTTGAGGGGCTAGTCTCTCAGGAGTTC |
Downstream region at tRNA end position |
acaattttra |
Secondary structure (Cloverleaf model) | >WENV170701536 Leu GAG T ATac acaattttra G - C C - G G - C G - C G - C C - G G - C T A T T A C C C A C C G A C + | | | | A T C C C G G T G G G C G | | | T T G A G G C C C A A G TCTCTCAGGAGTTC C - G T - A A - T G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |