Sequence ID | >WENV170702941 |
Genome ID | LKMJ01005021 |
Search identical group | |
Phylum/Class | [LKMJ] soda lake metagenome; sample PL-Br10; brine of Picturesque Lake |
Species | |
Start position on genome | 8876 |
End posion on genome | 8792 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ctcacaacga |
tRNA gene sequence |
GCGTGGGTAGCCAAGCCAGGCCAACGGCGCAGCGTTGAGGGCGCTGTCCTGTAGAGGTCC |
Downstream region at tRNA end position |
tatgcgtgac |
Secondary structure (Cloverleaf model) | >WENV170702941 Leu GAG a Atcg tatgcgtgac G - C C - G G - C T - A G - C G - C G - C T A T T G G C C A C C G A A + | | | | A A A C C G G C C G G C G | | | T T G C G G C C C A A G TCCTGTAGAGGTCC C - G A - T G - C C - G G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |