Sequence ID | >WENV170703360 |
Genome ID | LKMJ01010135 |
Search identical group | |
Phylum/Class | [LKMJ] soda lake metagenome; sample PL-Br10; brine of Picturesque Lake |
Species | |
Start position on genome | 683 |
End posion on genome | 603 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gcaaccacgg |
tRNA gene sequence |
GCCAGGATGGCCGAGTGGTAAGGCGCACGCCTGGAAAGCGTGTTCCCTTTGGGATCGGGG |
Downstream region at tRNA end position |
tctcggatca |
Secondary structure (Cloverleaf model) | >WENV170703360 Ser GGA g Gttt tctcggatca G - C C - G C - G A - T G - C G - C A - T T A T C T C C C A G A G | + | | | A T G C C G G G G G G C G | | | T T G A G G C T A G TTCCCTTTGGGATC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |