Sequence ID | >WENV170703395 |
Genome ID | LKMJ01010844 |
Search identical group | |
Phylum/Class | [LKMJ] soda lake metagenome; sample PL-Br10; brine of Picturesque Lake |
Species | |
Start position on genome | 5775 |
End posion on genome | 5698 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
acgccagcgc |
tRNA gene sequence |
GGGTTCGTGGTCTAGGCTGGTTATGACACCTCCTTGACATGGAGGAGGTCGGCAGTTCAA |
Downstream region at tRNA end position |
aaatttcaat |
Secondary structure (Cloverleaf model) | >WENV170703395 Val GAC c ATCA aaatttcaat G - C G - C G - C T - A T - A C - G G - C T A T C C G T C A C G G A G | | | | | A T T C T G G G C A G C G | | | T T G T G A C T T A A AGGTC C - G C - G T - A C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |