Sequence ID | >WENV170704138 |
Genome ID | LKMJ01023505 |
Search identical group | |
Phylum/Class | [LKMJ] soda lake metagenome; sample PL-Br10; brine of Picturesque Lake |
Species | |
Start position on genome | 4999 |
End posion on genome | 4913 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
cccgtcgcga |
tRNA gene sequence |
GCGGTCGTGGCGGAATTGGTAGACGCGCAGCGTTGAGGTCGCTGTGGGGTAACACCCGTG |
Downstream region at tRNA end position |
gaagatccag |
Secondary structure (Cloverleaf model) | >WENV170704138 Leu GAG a ACCA gaagatccag G - C C - G G - C G - C T - A C - G G - C T G T T C T T C A T A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C T A G G TGGGGTAACACCCGT C - G A - T G - C C - G G - C T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |