Sequence ID | >WENV170704208 |
Genome ID | LLEJ01000015 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 13897 |
End posion on genome | 13822 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ttaaaatagt |
tRNA gene sequence |
GACCTGTTAGCTCAGCTGGTAGAGCATCTCCCTTTTAAGGAGGTGGCCAATGGTTCGAAT |
Downstream region at tRNA end position |
gtttacttgt |
Secondary structure (Cloverleaf model) | >WENV170704208 Lys TTT t ACCA gtttacttgt G - C A - T C - G C - G T + G G - C T - A T A T T T A C C A C G A A | | | | | G T C T C G A A T G G C G | | | | T T G G A G C T A A TGGCC T + G C - G T - A C - G C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |