Sequence ID | >WENV170704322 |
Genome ID | LLEJ01002972 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1271 |
End posion on genome | 1198 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gagatacaac |
tRNA gene sequence |
GGCGCGTTGGCAGAGAGGCTATGCAGCGGATTGCAAATCCGTGGACCTCGGTTCGATTCC |
Downstream region at tRNA end position |
ttcctttatg |
Secondary structure (Cloverleaf model) | >WENV170704322 Cys GCA c TCCA ttcctttatg G - C G - C C - G G - C C - G G - C T - A T T T G G G C C A G A G | + | | | G A G A C G C T C G G C G | | | T T G A T G C C T A GGAC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |