Sequence ID | >WENV170704331 |
Genome ID | LLEJ01003571 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 176 |
End posion on genome | 260 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aagaaaaaat |
tRNA gene sequence |
GCCCGGGTGGTGGAATTGGTAGACACAAGGGATTTAAAATCCCTCGCCGAAAAGCGTGCC |
Downstream region at tRNA end position |
tttaaagtaa |
Secondary structure (Cloverleaf model) | >WENV170704331 Leu TAA t ACCA tttaaagtaa G + T C - G C - G C - G G - C G - C G + T T G T C G G C C A T A A G | | | | | A T G G T G G C C G G C G | | | T T G A C A C T A G A CGCCGAAAAGCGT A - T G - C G - C G - C A - T T A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |