Sequence ID | >WENV170704395 |
Genome ID | LLEK01000014 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 45927 |
End posion on genome | 46002 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
taaatgattt |
tRNA gene sequence |
GGTCGATTAGCTCAGTTGGTAGAGCGCTACCCTTACAAGGTAGATGTCATAAGTTCGAGT |
Downstream region at tRNA end position |
tgaattcttt |
Secondary structure (Cloverleaf model) | >WENV170704395 Val TAC t ACCA tgaattcttt G - C G - C T - A C - G G - C A - T T - A T G T T A T T C A T G A A | | | | | G T C T C G A T A A G C G | | | | T T G G A G C T A G ATGTC C - G T - A A - T C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |