Sequence ID | >WENV170704400 |
Genome ID | LLEK01000023 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 14571 |
End posion on genome | 14487 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
cagtaatttt |
tRNA gene sequence |
GGTGGGATTGGAGAGTGGTCAAATCCTGCGGATTGTAAATCCGCCGCCTACGGCTTCGAA |
Downstream region at tRNA end position |
tacttaagcg |
Secondary structure (Cloverleaf model) | >WENV170704400 Tyr GTA t ACCA tacttaagcg G - C G - C T - A G - C G - C G - C A - T T A T C T T C C A T G A T | | | | | A G G A G G G A A G G C G | | | T T T A T C C C A A T CGCCTACGGCTTC G - C C - G G - C G - C A - T T A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |