Sequence ID | >WENV170704433 |
Genome ID | LLEK01000273 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 5732 |
End posion on genome | 5642 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cgcttcacac |
tRNA gene sequence |
GGAGAGATGGCTGAGTGGTTGAAAGCACCGGTCTTGAAAACCGGCGATGGTTAATAGCTA |
Downstream region at tRNA end position |
cattagaaag |
Secondary structure (Cloverleaf model) | >WENV170704433 Ser TGA c GCCA cattagaaag G - C G - C A - T G - C A - T G - C A - T T A T A T C C C A T G A G | | | | | A G G T C G T A G G G C G | | | T T T A A G C T G A A CGATGGTTAATAGCTATCC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |