| Sequence ID | >WENV170704452 |
| Genome ID | LLEK01000487 |
| Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
| Species | |
| Start position on genome | 2326 |
| End posion on genome | 2250 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
taacttttaa |
| tRNA gene sequence |
GCGGGAGTAGCTCAGTTGGCTAGAGCCTCTGCCTTCCAAGCAGATTGTCGCGAGTTCGAG |
| Downstream region at tRNA end position |
cttaaaaaat |
| Secondary structure (Cloverleaf model) | >WENV170704452 Gly TCC
a TCCA cttaaaaaat
G - C
C - G
G - C
G - C
G - C
A - T
G - C T G
T T G C T C A
T G A A + | | | | G
T C T C G G C G A G C
G | | | | T T
G G A G C
C T A C TTGTC
T - A
C - G
T - A
G - C
C - G
C A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |