Sequence ID | >WENV170704471 |
Genome ID | LLEK01000783 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 121 |
End posion on genome | 195 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ttattgctgt |
tRNA gene sequence |
AGGTCTATCGCCAAGCGGTAAGGCACCGGCTTTTGATGCCGGCATTCCCTGGTTCGAATC |
Downstream region at tRNA end position |
ctatttaaac |
Secondary structure (Cloverleaf model) | >WENV170704471 Gln TTG t GCCA ctatttaaac A - T G - C G - C T - A C - G T - A A - T T A T G G A C C A G A C | | | | | G C A C C G C C T G G C G | | | T T G A G G C T A A CATTC C - G C - G G - C G - C C - G T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |