Sequence ID | >WENV170704472 |
Genome ID | LLEK01000783 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 275 |
End posion on genome | 359 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
aaagtttgct |
tRNA gene sequence |
GCGGTCGTGGCGGAATTGGTAGACGCACCAGATTTAGGTTCTGGCGCCGCAAGGTGTGAG |
Downstream region at tRNA end position |
tcatcattaa |
Secondary structure (Cloverleaf model) | >WENV170704472 Leu TAG t ACCA tcatcattaa G - C C - G G - C G - C T - A C - G G - C T G T C T C T C A T A A G | | | | | A T G G C G G A G A G C G | | | T T G A C G C T A G A CGCCGCAAGGTGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |