| Sequence ID | >WENV170704482 |
| Genome ID | LLEK01001180 |
| Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
| Species | |
| Start position on genome | 9 |
| End posion on genome | 84 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
nntaaaaatt |
| tRNA gene sequence |
GCGACACTAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGTCATCGGTTCGAAC |
| Downstream region at tRNA end position |
aatttaaaaa |
| Secondary structure (Cloverleaf model) | >WENV170704482 Gly GCC
t TCCA aatttaaaaa
G - C
C - G
G - C
A - T
C - G
A - T
C - G C A
T T A G C C A
T G A A | | | | | G
T C T C G A T C G G C
G | | | | T T
G G A G C
T A G AGGTC
C - G
A - T
A - T
C - G
C - G
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |