Sequence ID | >WENV170704486 |
Genome ID | LLEK01001228 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1883 |
End posion on genome | 1800 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gcccaaaaat |
tRNA gene sequence |
GGAGGGGTAGCGAAGTGGCTAAACGCGGCAGACTGTAAATCTGTTCCTAACGGTTCGGCA |
Downstream region at tRNA end position |
ttctatttat |
Secondary structure (Cloverleaf model) | >WENV170704486 Tyr GTA t ACCA ttctatttat G - C G - C A - T G - C G - C G - C G - C T A T C C G T C A T G A A | | | | | G G A G C G G G C A G C G | | | T T C A C G C T A A G TCCTAACGGTTC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |