Sequence ID | >WENV170704488 |
Genome ID | LLEK01001241 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 205 |
End posion on genome | 113 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tccgcaagac |
tRNA gene sequence |
GGTGAGGTGGCCGAGAGGCTGAAGGCGCTCCCCTGCTAAGGGAGTATACGGCTTGATACC |
Downstream region at tRNA end position |
ttcttgcact |
Secondary structure (Cloverleaf model) | >WENV170704488 Ser GCT c GCCA ttcttgcact G - C G - C T - A G - C A - T G + T G - C T A T C T C C C A A G A G | | | | | G G G C C G G A G G G C G | | | T T C A G G C T G A G TATACGGCTTGATACCGTATC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |