Sequence ID | >WENV170704491 |
Genome ID | LLEK01001377 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1331 |
End posion on genome | 1406 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gttgcatatt |
tRNA gene sequence |
GGCCCGTTGGAGAAACGGTTAACTCACATGCCTTTCACGCATGCACTCACGGGTTCGAAT |
Downstream region at tRNA end position |
tctttttaaa |
Secondary structure (Cloverleaf model) | >WENV170704491 Glu TTC t ACCA tctttttaaa G - C G + T C - G C - G C - G G - C T - A T A T T G C C C A C A A G | | | | | G G A G A G A C G G G C G | | | T T T A C T C T A A CACTC C - G A - T T - A G - C C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |