| Sequence ID | >WENV170704505 |
| Genome ID | LLEK01001722 |
| Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
| Species | |
| Start position on genome | 95 |
| End posion on genome | 11 |
| Amino Acid | Tyr |
| Anticodon | GTA |
| Upstream region at tRNA start position |
aaaataccct |
| tRNA gene sequence |
GGAGGGGTTCCCGAGTGGCCAAAGGGAGCAGACTGTAAATCTGCCGGCACTGCCTTCGAT |
| Downstream region at tRNA end position |
tatttctctc |
| Secondary structure (Cloverleaf model) | >WENV170704505 Tyr GTA
t ACCA tatttctctc
G - C
G - C
A - T
G - C
G - C
G - C
G - C T A
T C T G C C A
T G A T | | + | | G
G G C C C G A T G G C
G | | | T T
C A G G G
C A A A CGGCACTGCCTTC
G - C
C - G
A - T
G - C
A - T
C A
T A
G T A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |