Sequence ID | >WENV170704621 |
Genome ID | LLEL01011868 |
Phylum/Class | [LLEL] bioreactor metagenome; day35 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 210 |
End posion on genome | 123 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tcagagagtt |
tRNA gene sequence |
GGTGAGGTGTCCGAGTGGCCGAAGGAGCACGCCTGGAAAGTGTGTATACCGCAAGGTATC |
Downstream region at tRNA end position |
tcatttataa |
Secondary structure (Cloverleaf model) | >WENV170704621 Ser GGA t GCCA tcatttataa G - C G - C T - A G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G C C T G A G G G C G | | | T T C A G G A C G A G TATACCGCAAGGTATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |