Sequence ID | >WENV170704687 |
Genome ID | LLEM01000011 |
Phylum/Class | [LLEM] bioreactor metagenome; day64 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 38709 |
End posion on genome | 38784 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
gtcacaattt |
tRNA gene sequence |
GGGGCTATAGCTCAGCTGGGAGAGCGCTTCGCTGGCAGCGAAGAGGTCTGCGGTTCGATC |
Downstream region at tRNA end position |
aatttatgtg |
Secondary structure (Cloverleaf model) | >WENV170704687 Ala GGC t ACCA aatttatgtg G - C G - C G + T G - C C - G T - A A - T C T T A C G C C A C G A A | | | | | G T C T C G T G C G G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A C - G G - C C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |