Sequence ID | >WENV170704690 |
Genome ID | LLEM01000030 |
Phylum/Class | [LLEM] bioreactor metagenome; day64 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 32813 |
End posion on genome | 32736 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
nnatacaatT |
tRNA gene sequence |
CCCCCTTTAGTTCAGTTGGTAGAACGGCGGACTGTTAATCCGTATGTCGCAAGTTCAAGT |
Downstream region at tRNA end position |
Aaacttcaat |
Secondary structure (Cloverleaf model) | >WENV170704690 Asn GTT T AGCC Aaacttcaat C - G C - G C - G C - G C - G T - A T - A T G T C G T T C A T G A A | | | | | A T C T T G G C A A G C G | | | | T T G G A A C T A G ATGTC G + T C - G G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |