Sequence ID | >WENV170704698 |
Genome ID | LLEM01000093 |
Phylum/Class | [LLEM] bioreactor metagenome; day64 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 12821 |
End posion on genome | 12894 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
aacaaaataa |
tRNA gene sequence |
GGCGCGTTGGCAGAGTGGCTATGCAGCGGATTGCAAATCCGTGTACCTCGGTTCGACTCC |
Downstream region at tRNA end position |
tttcattctg |
Secondary structure (Cloverleaf model) | >WENV170704698 Cys GCA a TCCA tttcattctg G - C G - C C - G G - C C - G G - C T - A T C T G G G C C A G A G | + | | | G T G A C G C T C G G C G | | | T T G A T G C C T A GTAC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |