Sequence ID | >WENV170704728 |
Genome ID | LLEM01001010 |
Phylum/Class | [LLEM] bioreactor metagenome; day64 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 2079 |
End posion on genome | 2154 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aagtaattcc |
tRNA gene sequence |
CCCCCAATAGCTCAGTTGGTAGAGCGATGGACTGTTAATCCATGTGTCACTGGTTCAAGC |
Downstream region at tRNA end position |
cattttatgt |
Secondary structure (Cloverleaf model) | >WENV170704728 Asn GTT c GCCA cattttatgt C A C - G C - G C - G C - G A - T A - T C G T T G A C C A T G A A | | | | | A T C T C G A C T G G C G | | | | T T G G A G C T A G GTGTC A - T T - A G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |