Sequence ID | >WENV170704742 |
Genome ID | LLEM01002419 |
Phylum/Class | [LLEM] bioreactor metagenome; day64 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 601 |
End posion on genome | 512 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aaaaaatatt |
tRNA gene sequence |
GGTGAGCTGGCTGAGTGGCTGAAGGCGCACGCCTGGAAAGTGTGTTTAGGTTTATCCCTA |
Downstream region at tRNA end position |
tattttaaga |
Secondary structure (Cloverleaf model) | >WENV170704742 Ser GGA t GCCA tattttaaga G - C G - C T - A G - C A - T G - C C - G T A T C T C T C A T G A G | | | | | G G G T C G G A G A G C G + | | T T C A G G C T G A G TTTAGGTTTATCCCTAAC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |