Sequence ID | >WENV170704769 |
Genome ID | LLEM01009655 |
Phylum/Class | [LLEM] bioreactor metagenome; day64 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 94 |
End posion on genome | 183 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
acgcgtcggt |
tRNA gene sequence |
GGAGACGTGGCCGAGTGGTCGAAGGCGCTCCCCTGCTAAGGGAGTAGGCCCGGAAGGGTC |
Downstream region at tRNA end position |
tttcacaccc |
Secondary structure (Cloverleaf model) | >WENV170704769 Ser GCT t GCCA tttcacaccc G - C G - C A - T G - C A - T C - G G - C T A T T T C C C A T G A G + | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TAGGCCCGGAAGGGTCTC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |