Sequence ID | >WENV170704774 |
Genome ID | LLEM01011252 |
Phylum/Class | [LLEM] bioreactor metagenome; day64 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 126 |
End posion on genome | 42 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
agataacaat |
tRNA gene sequence |
GCCCGGGTGGTGGAATTGGTAGACACAAGGGATTTAAAATCCCTCGCCGAAAAGCGTGCC |
Downstream region at tRNA end position |
tttattactg |
Secondary structure (Cloverleaf model) | >WENV170704774 Leu TAA t ACCA tttattactg G + T C - G C - G C - G G - C G - C G + T T G T C G G C C A T A A G | | | | | A T G G T G G C C G G C G | | | T T G A C A C T A G A CGCCGAAAAGCGT A - T G - C G - C G - C A - T T A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |