Sequence ID | >WENV170704791 |
Genome ID | LLEN01000030 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 22496 |
End posion on genome | 22583 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
acaacaattt |
tRNA gene sequence |
GGTGAGGTGTCCGAGTGGCTGAAGGAGCACGCCTGGAAAGTGTGTATACGGCAACGTATC |
Downstream region at tRNA end position |
tatttaggaa |
Secondary structure (Cloverleaf model) | >WENV170704791 Ser GGA t GCCA tatttaggaa G - C G - C T - A G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G C C T G A G G G C G | | | T T C A G G A T G A G TATACGGCAACGTATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |