Sequence ID | >WENV170704793 |
Genome ID | LLEN01000033 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 27481 |
End posion on genome | 27554 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
aaagacattt |
tRNA gene sequence |
GGCGCGTTGGCAGAGTGGCTATGCAGCGGATTGCAAATCCGTGTACCTCGGTTCGACTCC |
Downstream region at tRNA end position |
ttcttttaaa |
Secondary structure (Cloverleaf model) | >WENV170704793 Cys GCA t TCCA ttcttttaaa G - C G - C C - G G - C C - G G - C T - A T C T G G G C C A G A G | + | | | G T G A C G C T C G G C G | | | T T G A T G C C T A GTAC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |