Sequence ID | >WENV170704795 |
Genome ID | LLEN01000076 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 20886 |
End posion on genome | 20961 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gcgctccgtt |
tRNA gene sequence |
GCCTCGATAGCTCAGTCGGTAGAGCAGAGGATTGAAAATCCTCGTGTCGGTGGTTCGATT |
Downstream region at tRNA end position |
ttattctctt |
Secondary structure (Cloverleaf model) | >WENV170704795 Phe GAA t ACCA ttattctctt G - C C - G C - G T - A C - G G - C A - T T T T C C G C C A T G A A | | + | | G C C T C G G G T G G C G | | | | T T G G A G C T A A GTGTC G - C A - T G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |