Sequence ID | >WENV170704833 |
Genome ID | LLEN01002502 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 190 |
End posion on genome | 100 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gtttacttca |
tRNA gene sequence |
GGTGAGATGGCTGAGTGGTCGAAAGCACCGGTCTTGAAAACCGGCAAGGGTTTGTAGCCC |
Downstream region at tRNA end position |
cattaagaaa |
Secondary structure (Cloverleaf model) | >WENV170704833 Ser TGA a GCCA cattaagaaa G - C G - C T - A G - C A - T G - C A - T T A T A T C T C A T G A G | | | | | A G G T C G T A G A G C G | | | T T T A A G C C G A A CAAGGGTTTGTAGCCCTTC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |