Sequence ID | >WENV170704841 |
Genome ID | LLEN01003072 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 166 |
End posion on genome | 80 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
acacacttgt |
tRNA gene sequence |
GCGAGTGTGGCGGAACTGGTAGACGCGCGGGACTTAAAATCCCGTTCCCGTTTGGGAGTG |
Downstream region at tRNA end position |
ctattgttag |
Secondary structure (Cloverleaf model) | >WENV170704841 Leu TAA t ACCA ctattgttag G - C C - G G - C A - T G + T T - A G - C T T T C A C T C A C A A G | | | | | G T G G C G G T G A G C G | | | T T G A C G C T A G G TTCCCGTTTGGGAGT C - G G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |