Sequence ID | >WENV170704887 |
Genome ID | LLEN01009419 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 290 |
End posion on genome | 372 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
taaagtgatt |
tRNA gene sequence |
GGGGAGATACTCAAGCGGCCAACGAGGGCAGACTGTAAATCTGCTGACTACGTCTTCGCA |
Downstream region at tRNA end position |
tattttagat |
Secondary structure (Cloverleaf model) | >WENV170704887 Tyr GTA t ACtt tattttagat G - C G - C G - C G - C A - T G - C A - T T A T C G T C C A C G A A | | | | | G G A C T C G C A G G C G | | | T T C C G A G C A A G TGACTACGTCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |